View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20002_low_17 (Length: 284)
Name: NF20002_low_17
Description: NF20002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20002_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 43666812 - 43667066
Alignment:
| Q |
19 |
ttgttaccccttggagatagatgtcttcatttacaagtatatggatactccactaatttaaccttttgtaaattgcctttcaaatcaagatgggtccatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666812 |
ttgttaccccttggagatagatgtcttcatttacaagtatatggatactccactaatttaaccttttgtaaattgcctttcaaatcaagatgggtccatt |
43666911 |
T |
|
| Q |
119 |
attaaatttcaatcccaccttacacgcataaggatgtgccacgtggaaatttgtataagcattatataaacgaggaataaagttttttctaaatttataa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666912 |
attaaatttcaatcccaccttacacgcataaggatgtgccacgtggaaatttgtataagcattatataaacgaggaataaagttttttctaaatttataa |
43667011 |
T |
|
| Q |
219 |
cgtatcttcatttctttattttagaaataataccacaaagaagtaagaacccttt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43667012 |
cgtatcttcatttctttattttagaaataataccacaaagaagtaagaacccttt |
43667066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University