View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20002_low_19 (Length: 231)
Name: NF20002_low_19
Description: NF20002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20002_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 231
Target Start/End: Original strand, 40531272 - 40531501
Alignment:
| Q |
2 |
aaatatcaaattaaaaactatataagatatgctcgaaattatacgtctgatatcaagtacctatataaaattgcatc-tgttcttgcaacggatcaacca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
40531272 |
aaatatcaaattaaaaactatataaaatatgctcgaaattatacgtctgatatcaagttcctatataaaattgcatcatgttcttgcaacggatcaaaca |
40531371 |
T |
 |
| Q |
101 |
gcatatccactcactacgcctctttctccttgcaattttgcttcaataataccaagctaaaaatgttctgattagcaaacaccttcagttttgtagggga |
200 |
Q |
| |
|
||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
40531372 |
gcaaatccactcaccacgcctctttctccttgcaattttgcttcaataataccaagctaaaaatgttctgattagcaaaaaccttcag-tttgtagggga |
40531470 |
T |
 |
| Q |
201 |
tattttaaagcataggcaaaagggattacat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40531471 |
tattttaaagcataggcaaaagggattacat |
40531501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University