View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20002_low_21 (Length: 220)
Name: NF20002_low_21
Description: NF20002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20002_low_21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 25 - 220
Target Start/End: Complemental strand, 37385938 - 37385739
Alignment:
| Q |
25 |
aacacaatccaatttaaattataaccacttgctcaaagtgtccgagagtctctc----actgcttagatcgatcaaccagatattttcggtttttcaaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385938 |
aacacaatccaatttaaattataaccacttgctcaaagtgtccgagagtctctctctcactgctgagatcgatcaaccagatattttcggtttttcaaag |
37385839 |
T |
|
| Q |
121 |
cagtatttattccatcacaagttcacaactcaagtcacattagagttagttactacacatgacaatgaaaggaggacagagaaagaaccttctatacaca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385838 |
cagtatttattccatcacaagttcacaactcaagtcacattagagttagttactacacatgacaatgaaaggaggacagagaaagaaccttctatacaca |
37385739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University