View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_29 (Length: 396)
Name: NF20003_high_29
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 31296731 - 31296459
Alignment:
| Q |
1 |
accataggagccattaccggggaaagcagcggcaagatcgccggggatgagaagaaggattagaccatcgccggcgtcgtgggaaatggagaaggtgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296731 |
accataggagccattaccggggaaagcagcggcaagatcaccggggatgagaagaaggattagaccatcgccggcgtcgtgggaaatggagaaggtgaat |
31296632 |
T |
 |
| Q |
101 |
tcaacggagaaggagatgggatcggtgaatgtgagaggttgacggcggaggaggaggccggcggtgagagaagagtggtgggtgagtttgacgtgggacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296631 |
tcaacggagaaggagatgggatcggtgaatgtgagaggttgacggcggaggaggaggccggcggtgagagaagagtggtgggtgagtttgacgtgggacc |
31296532 |
T |
 |
| Q |
201 |
cacctccgtttttgtcggggaaaagctttgcatcgccgtagagatcagtgtcagggtcgaaatttgggatatt |
273 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296531 |
cacctccggttttgtcggggaaaagctttgcatcgccgtagagatcagtgtcagggtcgaaatttgggatatt |
31296459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 378
Target Start/End: Complemental strand, 31296390 - 31296354
Alignment:
| Q |
342 |
ccatgttgctatgtttttctatgggaaaacaaagaac |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296390 |
ccatgttgctatgtttttctatgggaaaacaaagaac |
31296354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University