View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_32 (Length: 385)
Name: NF20003_high_32
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 3945821 - 3945448
Alignment:
| Q |
1 |
ctcatcaaaataccctccaccattgatacttctatttcttcttctccttcttcaactcctagttccacaccaaacaccacttcttcaaattcaaccttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945821 |
ctcatcaaaataccctccaccattgatacttctatttcttcttctccttc---aactcctagttccacaccaaacaccacttcttcaaattcaaccttaa |
3945725 |
T |
 |
| Q |
101 |
atcataatattagtcctatgttttatggtttatcaagtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945724 |
atcataatattagtcctatgttttatggtttatcaagtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaag |
3945625 |
T |
 |
| Q |
201 |
ttcaggttatgattttcagcctcagatgaatactattggattaggcttttcatccgggtttacgtccagtgaagccaatgatcataatggttatacaaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945624 |
ttcaggttatgattttcagcctcagatgaatactattggattaggcttttcatctgggtttacgtccagtgaagccaatgatcataatggttatacaaat |
3945525 |
T |
 |
| Q |
301 |
ggatttacttcaagatatggttcaatctttagttcttcttctgtaccaagtaatgcatcagttatgccctctctgct |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3945524 |
ggatttacttcaagatatggttcaatctttagttcttcttctgtaccaagtaatgcatcagttatgccttctctgct |
3945448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University