View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_45 (Length: 329)
Name: NF20003_high_45
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 269
Target Start/End: Complemental strand, 42449648 - 42449393
Alignment:
| Q |
17 |
tgggtggcatggacgaagacgtgtgtgtgtg--gtggtagtatgtcgagtttggtaaattgaagtc-aacggaagagattaacatacaaggaggattgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
42449648 |
tgggtggcatggacgaagacgtgtgtgtgtgtggtggtagtatgtcgagtttggtaaattgaagtccaacggaagagattaacatacaaagaggattgaa |
42449549 |
T |
 |
| Q |
114 |
gcaaggggacccgcttgcttctttcttgtttcttcaagtggcgaaatgatttagtgggttgatgaagaatgtagtgaaccttaatatgtttaaggggttc |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42449548 |
gcaaggggacccccttgcttctttcttgtttcttcaagtggtgaaatgatttagtgggttgatgaagaatgtagtgaaccttaatatgtttaaggggttc |
42449449 |
T |
 |
| Q |
214 |
aagtttacgagggaggggatgaagatttctcatttacaatttgtcgacgacactct |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42449448 |
aagtttacgagggaggggatgaagatttctcatttacaatttgtcgacgacactct |
42449393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 119
Target Start/End: Original strand, 20792848 - 20792932
Alignment:
| Q |
36 |
cgtgtgtgtgtggtggtagtatgtcgagtttggtaaattgaagt-caacggaagagattaacatacaaggaggattgaagcaagg |
119 |
Q |
| |
|
||||||| ||||||||||||||||| | |||||| ||| | ||| |||||||||| ||||| || ||| ||||||| || ||||| |
|
|
| T |
20792848 |
cgtgtgtatgtggtggtagtatgtccattttggttaatggtagtccaacggaagaaattaatattcaaagaggattaaaacaagg |
20792932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University