View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_47 (Length: 326)
Name: NF20003_high_47
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 3945468 - 3945152
Alignment:
| Q |
1 |
atcagttatgccctctctgctgcaacataaattcatcaatgatggtagcaacagttttcagggcttggaattcaacaatttggggaatggaagtgagaaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945468 |
atcagttatgccttctctgctgcaacataaattcatcaatgatggtagcaacagttttcagggcttggaattcaacaatttggggaatggaagtgagaaa |
3945369 |
T |
 |
| Q |
101 |
ggaatgaagaaagatgaaggagagatggagcatgtgggtggtttgtatgatccagctgcttcttcactttactggaatacagcatcatcatcagctattg |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945368 |
ggaacgaagaaagatgaaggagagatggagcatgtgggtggtttgtatgatccagctgcttcttcactttactggaatacagcatcatcatcagctattg |
3945269 |
T |
 |
| Q |
201 |
gtgtttggaacgatcaagcttctaatattggttcatcagttacttctttgatctagagtgaacaataaacttaatcctcagttcaagttcaaggtcatc- |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3945268 |
gtgtttggaacgatcaagcttctaatattggttcatcagttacttctttgatctagagtgaacaataaactcaatcctcagttcaagttcaaggtcatct |
3945169 |
T |
 |
| Q |
300 |
ttaatttggtacctttg |
316 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3945168 |
ttaatttggtacctttg |
3945152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University