View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_67 (Length: 253)
Name: NF20003_high_67
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 31214660 - 31214500
Alignment:
| Q |
1 |
tatttctaccaacttaactaagttcacgagaacgattttatacttatattgatgaaacaagagactattcaagctaatatgaagaaaacaatttattagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
31214660 |
tatttctaccaacttaactaagttcacaaagacgattttatacttatattgatgaaacaagagactattcaagttaatacgaagaaaacaatttattagt |
31214561 |
T |
 |
| Q |
101 |
ttttggtttaaatgcattttaggtcccttaacttttaaaaacttgcgattttgactccaac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31214560 |
ttttggtttaaatgcattttaggtcccttaacttttaaaaacttgcaattttgactccaac |
31214500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 153
Target Start/End: Complemental strand, 30666097 - 30666053
Alignment:
| Q |
109 |
taaatgcattttaggtcccttaacttttaaaaacttgcgattttg |
153 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
30666097 |
taaatgcacttttggtcccttaacttttaaaaacttgtgattttg |
30666053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 154
Target Start/End: Original strand, 43335924 - 43335978
Alignment:
| Q |
100 |
tttttggtttaaatgcattttaggtcccttaacttttaaaaacttgcgattttga |
154 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
43335924 |
ttttaggtttaaatgcattcgtgatcccttaacttttaaaaagttgcgattttga |
43335978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University