View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_74 (Length: 245)
Name: NF20003_high_74
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_74 |
 |  |
|
| [»] scaffold0187 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0187 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 2859 - 2638
Alignment:
| Q |
19 |
ctacttgctatagcagataaaattcaaaaggtttgccattgaaactctttttagtgtatatgatgggcgccttgaaagaaaaagcagtttgtttcacttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2859 |
ctacttgctatagcagataaaattcaaaaggtttgccattgaaactctttttagtgcatatgatgggcgccttgaaagaaaaagcagtttgtttcacttg |
2760 |
T |
 |
| Q |
119 |
atatgagatttctatgaataacatatttaaggtcacacgatgtgtcaagtgagataattttcttatacaagagtgagaagtgggatgcaaattcctttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2759 |
atatgagatttctatgaataacatatttaaggtcacacgatgtgtcaagtgagataattttcttatacaagagtgagaagtgggatgcaaattcctttca |
2660 |
T |
 |
| Q |
219 |
ctcggggaaattatacattcac |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2659 |
ctcggggaaattatacattcac |
2638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University