View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_75 (Length: 245)
Name: NF20003_high_75
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 45591470 - 45591255
Alignment:
| Q |
14 |
aaaatataaacacatgaatttagaagaatatgtatatattttagtgtcatactctgaactatgacaagagctttggagtcatcaacaactggaggaggag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45591470 |
aaaatataaacacatgaatttagaagaatatgtatatattttagtgtcatactctgaactatgacaagagctttggagtcatcaacaactggaggaggag |
45591371 |
T |
 |
| Q |
114 |
ga------ttgttatcttgtggaattacagatttctcctcagctacatctttctttggagcctcagggagaggagtagtagtagtctcagttgaagaagc |
207 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45591370 |
gaggaggattgttatcttgtggaattacagatttctcctcagctacatctttctttggagcctcagggagaggagtagtagtagtctcagtt---gaagc |
45591274 |
T |
 |
| Q |
208 |
aggtggtggtggaggattc |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45591273 |
aggtggtggtggaggattc |
45591255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University