View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_85 (Length: 221)
Name: NF20003_high_85
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 2925767 - 2925571
Alignment:
| Q |
18 |
gttatttgttattgttcgtttttgtactcaacctgtaatattgttatatttctttcatatactttcaacatgaagtaatgtgcattaagtttttagaata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2925767 |
gttatttgttattgttcgtttttgtactcaacctgtaatattgctatatttctttcatatactttcagcatgaagtaatgtgcattaagtttttagaata |
2925668 |
T |
 |
| Q |
118 |
taaataaaggattcaattgatatgcattaacatcgtaatgattttttacactgtcaatcaatcttagagagaaaactaaattgttcttatattcttc |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925667 |
taaataaaggattcaactgatatgcattaacatcgtaatgattttttacactgtcaatcaatcttagagagaaaactaaattgttcttatattcttc |
2925571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University