View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_high_90 (Length: 205)
Name: NF20003_high_90
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_high_90 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 2496005 - 2495827
Alignment:
| Q |
20 |
ctttggtacttctaaaaaattttaaagatgaagatgagaagtgatcatatagatatttgattcaagatttactttttccctcaaatctacatactaatgc |
119 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
2496005 |
ctttggtacttctaaaaatttttaaaaatgaagatgagaagtgatcatatagatatttgattcaagatttactttttccttcaaatccacatactaatgc |
2495906 |
T |
 |
| Q |
120 |
agctgaag--nnnnnnnnnnngtttgaattgagagtaattctgcagctgaagttctatatgactaggttgatgatgatg |
196 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2495905 |
agctgaagtttttttttttttgtttgaattgagagtaatcctgcagctgaagttctatatgactaggttgatgaagatg |
2495827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University