View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_42 (Length: 339)
Name: NF20003_low_42
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 16 - 145
Target Start/End: Original strand, 31214710 - 31214839
Alignment:
| Q |
16 |
atataaacacaaaatctttataattctggtgctaaatttaaaaagaaaacacaaagacttaatttgccggcattataaaattttataaatttagatgact |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31214710 |
atataaacacaaaatctttataattctggtgctaaatttaaaaagaaaatacaaagacttaatttgccggcattataaaattttataaatttagatgact |
31214809 |
T |
 |
| Q |
116 |
aaattaaccgaccatttcaatttcaaggtc |
145 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
31214810 |
aaattaaccgaccatttcgatttcaaggtc |
31214839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 190 - 323
Target Start/End: Original strand, 31214884 - 31215024
Alignment:
| Q |
190 |
gttatttattatatcacacggtgtcactatcttgtgctattcttcattaccaagctggaaaaagagaggca-------tcaagtccctactaagtttggt |
282 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31214884 |
gttatttatcatatcacacagtgtcactatcttgtgctattcttcattaccaagctggaaaaagagaggcatcaagattcaagtccctactaagtttggt |
31214983 |
T |
 |
| Q |
283 |
actttgttagtctttcacatcaaaatttcagcctattgtga |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31214984 |
actttgttagtctttcacatcaaaatttcagcctattgtga |
31215024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University