View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_51 (Length: 308)
Name: NF20003_low_51
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 223
Target Start/End: Original strand, 33318077 - 33318293
Alignment:
| Q |
10 |
atgtcttctactgtgaacaaaacggtaaatagttatcacattgttaaatatattgtttaattaacatgtttaatttatatcctcaatactacaagttaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33318077 |
atgtcttctactgtgaacaaaacggtaaatagttatcacattgttaaatatattgtttaattaacatgtttaatttatatcctcaatactacaagttaat |
33318176 |
T |
 |
| Q |
110 |
atcattggagtagcttcgtgtagtgataaggaaaaaaggataattgtttagcaaagcaacaggaggcaagcaagg---tcaattatagggggaaaagttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
33318177 |
atcattggagtagcttcgtgtagtgataaggaaaaaaggataattgtttagcaaagcaacaggaggcaagcaaggtcatcaattatagggggcaaagttt |
33318276 |
T |
 |
| Q |
207 |
gctaaagtgaataaaga |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33318277 |
gctaaagtgaataaaga |
33318293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University