View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20003_low_55 (Length: 286)

Name: NF20003_low_55
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20003_low_55
NF20003_low_55
[»] chr2 (3 HSPs)
chr2 (17-275)||(12861334-12861592)
chr2 (142-275)||(12844050-12844183)
chr2 (17-137)||(12843889-12844009)


Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 12861592 - 12861334
Alignment:
17 atatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccattgaacgc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12861592 atatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccattgaacgc 12861493  T
117 cgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcggtaacggt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
12861492 cgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcatagtacggagccagtttgttacaacggaagcagtggcggtaacggt 12861393  T
217 gacttcgaagttgatttggctttcatgaatgtagacatggtaagtgcgaaagttttcat 275  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||    
12861392 gacttcgaagttgatttggctttcgtgaatgtagacatggtaagtgcgaaggttttcat 12861334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 142 - 275
Target Start/End: Original strand, 12844050 - 12844183
Alignment:
142 gcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcggtaacggtgacttcgaagttgatttggctttca 241  Q
    ||||||| ||||||  ||||||| ||||||  |  ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
12844050 gcggagggattgaaaatgatgattgagcatactttggagccagtttgttacgacggaagctgtggcggtaacggtgacttcgaagttgatttggctttca 12844149  T
242 tgaatgtagacatggtaagtgcgaaagttttcat 275  Q
    ||||||||||||||||||||||||| ||||||||    
12844150 tgaatgtagacatggtaagtgcgaaggttttcat 12844183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 17 - 137
Target Start/End: Original strand, 12843889 - 12844009
Alignment:
17 atatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccattgaacgc 116  Q
    ||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |  ||||||||||||||    
12843889 atatcggcgagagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggatcaaggttgccgggagtccattgaacgc 12843988  T
117 cgaggccgacaacaagattac 137  Q
    | ||||||||||  |||||||    
12843989 caaggccgacaatgagattac 12844009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University