View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_55 (Length: 286)
Name: NF20003_low_55
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 12861592 - 12861334
Alignment:
| Q |
17 |
atatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccattgaacgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12861592 |
atatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccattgaacgc |
12861493 |
T |
 |
| Q |
117 |
cgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcggtaacggt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12861492 |
cgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcatagtacggagccagtttgttacaacggaagcagtggcggtaacggt |
12861393 |
T |
 |
| Q |
217 |
gacttcgaagttgatttggctttcatgaatgtagacatggtaagtgcgaaagttttcat |
275 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
12861392 |
gacttcgaagttgatttggctttcgtgaatgtagacatggtaagtgcgaaggttttcat |
12861334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 142 - 275
Target Start/End: Original strand, 12844050 - 12844183
Alignment:
| Q |
142 |
gcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcggtaacggtgacttcgaagttgatttggctttca |
241 |
Q |
| |
|
||||||| |||||| ||||||| |||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844050 |
gcggagggattgaaaatgatgattgagcatactttggagccagtttgttacgacggaagctgtggcggtaacggtgacttcgaagttgatttggctttca |
12844149 |
T |
 |
| Q |
242 |
tgaatgtagacatggtaagtgcgaaagttttcat |
275 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
12844150 |
tgaatgtagacatggtaagtgcgaaggttttcat |
12844183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 17 - 137
Target Start/End: Original strand, 12843889 - 12844009
Alignment:
| Q |
17 |
atatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccattgaacgc |
116 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
12843889 |
atatcggcgagagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggatcaaggttgccgggagtccattgaacgc |
12843988 |
T |
 |
| Q |
117 |
cgaggccgacaacaagattac |
137 |
Q |
| |
|
| |||||||||| ||||||| |
|
|
| T |
12843989 |
caaggccgacaatgagattac |
12844009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University