View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_65 (Length: 262)
Name: NF20003_low_65
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 4434228 - 4434085
Alignment:
| Q |
1 |
gaaatttgattcctttcagctagattcgataacccttttggctaaaaacttcaatgcggtctttcaaaagaccaaacaataactcagattcaaagggtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4434228 |
gaaatttgattcctttcagctagattcgataacccttttggctaaaaacttcaatgcggtctttcaaaagaccaaacaataactcagattcaaagggtca |
4434129 |
T |
|
| Q |
101 |
tgttggatctgatggtggattttgtgaaaccttgtgaaagaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4434128 |
tgttggatctgatggtggattttgtgaaaccttgtgaaagaaaa |
4434085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 210 - 247
Target Start/End: Complemental strand, 4434016 - 4433979
Alignment:
| Q |
210 |
aagaagaaatagtagtaaagtgttgttattgtcgttta |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4434016 |
aagaagaaatagtagtaaagtgttgttattgtcgttta |
4433979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University