View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_69 (Length: 252)
Name: NF20003_low_69
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 41268972 - 41268809
Alignment:
| Q |
1 |
tcagtgggtgttccttcgccggagttagtggtggttacttccattgtgacggcggtgttatcgagagttagaatagagatagggatataatggtcatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41268972 |
tcagtgggtgttccttcgccggagttagtggtggttacttccattgtgacggcggtgttatcgaaagttagaatagagataggggtataatggtcatttt |
41268873 |
T |
|
| Q |
101 |
ttcatgttgttttgtttgtcagagatggtgagagagtgggacttggttgacttgaaacattgta |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41268872 |
ttcatgttgttttgtttgtcagagatggtgagagagtgggacttggttgacttgaaacattgta |
41268809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University