View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_70 (Length: 251)
Name: NF20003_low_70
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 35823139 - 35822917
Alignment:
| Q |
18 |
ataacttgggaggatgttgctgttctgatctcttacacatttgtcattttgaaaaacatttttgcacaaattggaaataaaaagaagggtaaaaggccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35823139 |
ataacttgggaggatgttgctgttctgatctcttacacatttgtcattttgaaaaacatttttgcacaaattggaaataaaaagaagggtaaaaggccaa |
35823040 |
T |
 |
| Q |
118 |
agtatttgaaagttcccaagtatcttggaaattggcaaaccctcatgaaaaccatttggaatcttgtgcagacaaatctagcagaatttaaagcacagga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35823039 |
agtatttgaaagttcccaagtatcttggaaattggcaaaccctcatgaaaaccatttggaatcttgtgcagacaaatctagcagaatttaaagcacagga |
35822940 |
T |
 |
| Q |
218 |
gatagcaaaactgcagaattcat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35822939 |
gatagcaaaactgcagaattcat |
35822917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 235
Target Start/End: Original strand, 47699288 - 47699339
Alignment:
| Q |
184 |
tgcagacaaatctagcagaatttaaagcacaggagatagcaaaactgcagaa |
235 |
Q |
| |
|
||||||| ||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
47699288 |
tgcagaccaatctagaagaatccaaagcacaagagatagcaaaactgcagaa |
47699339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University