View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_72 (Length: 250)
Name: NF20003_low_72
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 39429144 - 39428906
Alignment:
| Q |
1 |
cgtctctacttcttcctttcttgctgattgttatcgtgccggcgaccccgattccggcaagagaaactatacttacatggacgctgttcgatctattctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39429144 |
cgtctctacttcttcctttcttgctgattgttatcgtgccggcgacccccattccggcaagagaaactatacttacatggacgctgttcgctctattctt |
39429045 |
T |
 |
| Q |
101 |
ggtaaaactgcttctcctttattatatttgacaaacagattatgttccttcgataacaaaaatattactaagtgtcaaaggtcttggagataacatggac |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39429044 |
ggtaacactgcttctcctttattatatttgacaaacagattatgttccttcgataacaaaaatattactaagtgtcaaaggtcttggagataacatggac |
39428945 |
T |
 |
| Q |
201 |
tgaaatatt-ttttgcaggtggagctaaggttacatttt |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39428944 |
tgaaatatttttttgcaggtggagctaaggttacatttt |
39428906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 27 - 105
Target Start/End: Original strand, 6249475 - 6249553
Alignment:
| Q |
27 |
attgttatcgtgccggcgaccccgattccggcaagagaaactatacttacatggacgctgttcgatctattcttggtaa |
105 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6249475 |
attgttatcgcaccggtgaccctgattccggcaagagaaaatatacttacatggacgctgttcgctccattcttggtaa |
6249553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 238
Target Start/End: Original strand, 6249672 - 6249721
Alignment:
| Q |
189 |
gataacatggactgaaatattttttgcaggtggagctaaggttacatttt |
238 |
Q |
| |
|
|||||| ||||||||||| | ||||||||||||||| |||||||| |||| |
|
|
| T |
6249672 |
gataacgtggactgaaatgtattttgcaggtggagcaaaggttacgtttt |
6249721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University