View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_74 (Length: 247)
Name: NF20003_low_74
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_74 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 22 - 247
Target Start/End: Original strand, 6711140 - 6711365
Alignment:
| Q |
22 |
gtgggatcatatccttttgaagatcccgataatccaaaggacttccggaagacaattcaggttgatcagatattaagctgtttgcatgttttctttatgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711140 |
gtgggatcatatccttttgaagatcccgataatccaaaggacttccggaagacaattcaggttgatcagatattaagctgtttgcatgttttctttatgc |
6711239 |
T |
 |
| Q |
122 |
gcctctgattgtgtgagcccgactggttttggttggttccctgcagagggttctcagtgtccagtattccgttccagactttgttcaaatatctcctgaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711240 |
gcctctgattgtgtgagcccgactggttttggttggttccctgcagagggttctcagtgtccagtattccgttccagactttgttcaaatatctcctgaa |
6711339 |
T |
 |
| Q |
222 |
tgtcgtgaagttatatcaagaatctt |
247 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6711340 |
tgtcgtgaagttatatcaagaatctt |
6711365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 226
Target Start/End: Complemental strand, 34126865 - 34126790
Alignment:
| Q |
151 |
tggttggttccctgcagagggttctcagtgtccagtattccgttccagactttgttcaaatatctcctgaatgtcg |
226 |
Q |
| |
|
|||||| |||| ||||||| || |||||||||||||||||| |||||||| |||||| ||| |||| || ||||| |
|
|
| T |
34126865 |
tggttgcttccttgcagagagtactcagtgtccagtattccattccagacaatgttcagataactccagagtgtcg |
34126790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University