View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_81 (Length: 239)
Name: NF20003_low_81
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 41268996 - 41269165
Alignment:
| Q |
1 |
aaaattcgatggcaagatacaagttgatgtcgccggcgaagcttccgatctcaaggtcgccgtgcatcacaatacctgccgggtatagtcctacgtcgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41268996 |
aaaattcgatggcaagatacaagttgatgtcgccggcgaagcttccgatctcaaggtcgccgtgcatcacaatacctgccgggtatagtcctacgtcgtt |
41269095 |
T |
 |
| Q |
101 |
gttggagtctccggttcttctttcaaacatgaaggtcagttttcgaagtgtttggtgagggtgaaacagt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41269096 |
gttggagtctccggttcttctttcaaacatgaaggtcagttttcgaagtgtttggtgagggtgaaacagt |
41269165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 22291743 - 22291790
Alignment:
| Q |
15 |
agatacaagttgatgtcgccggcgaagcttccgatctcaaggtcgccg |
62 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22291743 |
agatacaagctgatgtcgccggcgaagcttccgatctctaggtcgccg |
22291790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University