View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_83 (Length: 228)
Name: NF20003_low_83
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_83 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 34107439 - 34107639
Alignment:
| Q |
17 |
actactgctctgaatgttgatcagacaaacacctcggtgcttaattctgacatcaaaaccatgccgtcaggtgctgctttgccaccactgtcattgccct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34107439 |
actactgctctgaatgttgatcagacaaacacttcggtgcttaattctgacatcaaaaccatgccgtcaggtgctgctttgccaccactgtcattgccct |
34107538 |
T |
 |
| Q |
117 |
taaccactggagcaagaggaactggtcaggatcaggcagtagtgggcgttctgaccgagtcgtctgctaatgtttcttctgctgccgcggtagtctctgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34107539 |
taaccactggagcaagaggaactggtcaggatcaggcagtagtgggcgttctgaccgagtcgtctgctaatgtttcttctgctgccgcggtagtttctgc |
34107638 |
T |
 |
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
34107639 |
t |
34107639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University