View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20003_low_85 (Length: 227)
Name: NF20003_low_85
Description: NF20003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20003_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 2925180 - 2925401
Alignment:
| Q |
1 |
caatcacatttctaaattgtggcctgcaattgcaattgcgactgcaacggaca--tttgttagcatattactgcaatatcaagatttccaacataaacgg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
2925180 |
caatcacatttctaaattgtggcctgcaattgcaattgcgactgcaacggacacatttgttagcatattactgcaa------gatttccaacataaccgg |
2925273 |
T |
|
| Q |
99 |
aactgcaaattaaaatcacgatcacaagtattatattgcatcatgtatgtactttcaaatagtattgaggttcttacccatcctactagaccctttcctc |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925274 |
aaccgcaaattaaaatcacgatcacaagtattatattgcatcatgtatgtactttcaaatagtattgaggttcttacccatcctactagaccctttcctc |
2925373 |
T |
|
| Q |
199 |
caagtcttttgtctgtagtcctcattcc |
226 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
2925374 |
caagtcttttgtcagtagtcctcattcc |
2925401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 227
Target Start/End: Original strand, 2970065 - 2970099
Alignment:
| Q |
193 |
ttcctccaagtcttttgtctgtagtcctcattcca |
227 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2970065 |
ttcctccaagtcttttgtctgtagttctcattcca |
2970099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University