View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20004_high_6 (Length: 273)
Name: NF20004_high_6
Description: NF20004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20004_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 52262993 - 52263243
Alignment:
| Q |
16 |
cagaacccactttccgaaatatcgccgtcgccatctccgtcgtcagcgacggcgccagctctggtcctttcaaactcaggaaaacggatcgatcaagcag |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52262993 |
cagaacccactttccgaaatatcaccgtcgccatctccgtcgtcagcgacggcgccagctctggtcctttcaaactcaggaaaacggatcgatcaagcag |
52263092 |
T |
 |
| Q |
116 |
ggaagaagaagtacgtaaagcaagtaacgggtcgtcacaacgatactgagcttcatctagcagctcaaagaggtgatgttggtgctgtgagacagatcct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263093 |
ggaagaagaagtacgtaaagcaagtaacgggtcgtcacaacgatactgagcttcatctagcagctcaaagaggtgatgttggtgctgtgagacagatcct |
52263192 |
T |
 |
| Q |
216 |
tcttgatattgattctcaaataatgggtactttgagtggtgatgatgatgt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263193 |
tcttgatattgattctcaaataatgggtactttgagtggtgatgatgatgt |
52263243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University