View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20004_low_8 (Length: 236)
Name: NF20004_low_8
Description: NF20004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20004_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 2619048 - 2618827
Alignment:
| Q |
1 |
cctctcattttcttctcattgtacctgtttacaccaaaaaa-tatataattagtcgaatcatgtattgaccaattgactaaagtggaatcaactgatgca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2619048 |
cctctcattttcttctcattgtacctgtttacaccaaaaaaatatataattagtcgaatcatgtattgaccaattgactaaagtggaatcaactgatgca |
2618949 |
T |
|
| Q |
100 |
aaatcagtaccatagttttatgtagttctttctttgttcccaaagttttgatgaggctgcaattccgaacactacatgccggagctcggttcttttagaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2618948 |
aaatcagtaccatagttttatgtagttctttctttgttcccaaagttttgatgaggctgcaattccaaacactacatgccggagctcggttcttttagaa |
2618849 |
T |
|
| Q |
200 |
gaagaaatggcagtgctgtttg |
221 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
2618848 |
gaagaaatggtagtgctgtttg |
2618827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University