View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20005_low_4 (Length: 286)
Name: NF20005_low_4
Description: NF20005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20005_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 12 - 272
Target Start/End: Complemental strand, 48679966 - 48679703
Alignment:
| Q |
12 |
atgaatgtcactatcttcctgattaatggagtttgtttgaaaattccaatttaagttacactatcactcacgggacttaatttgattgcagaagtaattg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48679966 |
atgaatgtcactatcttcctgattaatggagtttgtttgaaaattccaatttaagttacactatcactcacgggacttaatttgattgcagaagtaactg |
48679867 |
T |
|
| Q |
112 |
gttagctaaagtaatttcccttagctaaaagtggaatgctagtttgttatcaattgatttatgttaatgcgagtatacgattcttttgcttt--tataga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48679866 |
gttagctaaagtaatttcccttagctaaaagtggaatgctagtttcttatcaattgatttatgttaatgcgagtatacgattcttttgcttttatataga |
48679767 |
T |
|
| Q |
210 |
ctcggtaaataaatgtttttggttattataaatatacaa-ttttgttttttgatcgttgatctt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
48679766 |
ctcggtaaataaatgtttttggttattataaatatacaattttttttttttgatcgttgatctt |
48679703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University