View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20006_low_11 (Length: 205)

Name: NF20006_low_11
Description: NF20006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20006_low_11
NF20006_low_11
[»] chr1 (2 HSPs)
chr1 (34-81)||(1410930-1410977)
chr1 (136-195)||(1411032-1411094)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 81
Target Start/End: Original strand, 1410930 - 1410977
Alignment:
34 acaacatttggattaaaagtacaagtctgggtgtaattagtactgaac 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
1410930 acaacatttggattaaaagtacaagtctgggtgtaattagtactgaac 1410977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 136 - 195
Target Start/End: Original strand, 1411032 - 1411094
Alignment:
136 gtatcatagagggatcttttactttttaaggatat---aaagtaggcatgttctatgatgatg 195  Q
    |||||||||||||||||||||||||||||||||||   ||||||||||||||||||| |||||    
1411032 gtatcatagagggatcttttactttttaaggatataaaaaagtaggcatgttctatggtgatg 1411094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University