View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20006_low_11 (Length: 205)
Name: NF20006_low_11
Description: NF20006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20006_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 81
Target Start/End: Original strand, 1410930 - 1410977
Alignment:
| Q |
34 |
acaacatttggattaaaagtacaagtctgggtgtaattagtactgaac |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1410930 |
acaacatttggattaaaagtacaagtctgggtgtaattagtactgaac |
1410977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 136 - 195
Target Start/End: Original strand, 1411032 - 1411094
Alignment:
| Q |
136 |
gtatcatagagggatcttttactttttaaggatat---aaagtaggcatgttctatgatgatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
1411032 |
gtatcatagagggatcttttactttttaaggatataaaaaagtaggcatgttctatggtgatg |
1411094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University