View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20006_low_9 (Length: 208)
Name: NF20006_low_9
Description: NF20006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20006_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 27922673 - 27922862
Alignment:
| Q |
16 |
ccatgtacaagtaatagatacttgaattccttaagtatgtggttagaaattcagtttctgatcaatattaaaannnnnnnnnnnnnnnnn----cattga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||| |
|
|
| T |
27922673 |
ccatgtacaagtaatagatacttgaattccttaagtatgtggttagagattcaatttctgatcaatattaaaaataaaaaataaaaaacatatacattga |
27922772 |
T |
 |
| Q |
112 |
gggatgtcgatttaaaaatatctcatttatccgctgaaattactctctgcaattatatacatgtatacttttttgaatggttaacctttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27922773 |
gggatgtcgatttaaaaatatctcatttatccgctgaaattagtctctgcaattatatacatgtatacttttttgaatggttaacctttg |
27922862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University