View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20007_high_1 (Length: 368)
Name: NF20007_high_1
Description: NF20007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20007_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 48789957 - 48790243
Alignment:
| Q |
19 |
acttacccattcatttagctgctcgggctgggaacttgactaaagtcaaagagatactacttcaaaaccatgaggcagcaaaggacttgttggcaaagca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48789957 |
acttacccattcatttagctgctcgggctgggaacttgactaaagtcaaagagatactacttcaaaaccatgaggcagcaaaggacttgttggcaaagca |
48790056 |
T |
 |
| Q |
119 |
gaacctcgagggggagacccctctttacgtcgcttctgagaacggacatgatttggttgttagcgagatactcaaatacttggacttgcaaactgcttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48790057 |
gaacctcgagggggagacccctctttacgtcgcttctgagaacggacatgatttggttgttagcgagatactcaaatacttggacttgcaaactgcttct |
48790156 |
T |
 |
| Q |
219 |
attgtcgccagaaatggttatgatcccttccatgttgctgcaaagcagggtcatcttggtaagtaagtttcagatcatgtttgtgtt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48790157 |
attgtcgccagaaatggttatgatcccttccatgttgctgcaaagcagggtcatcttggtaagtaagtttcagatcatgtttgtgtt |
48790243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 305 - 333
Target Start/End: Original strand, 48790257 - 48790285
Alignment:
| Q |
305 |
taccatgtctcactataactctgactgag |
333 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48790257 |
taccatgtctcactataactctgactgag |
48790285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University