View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20007_high_7 (Length: 238)
Name: NF20007_high_7
Description: NF20007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20007_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 12874506 - 12874397
Alignment:
| Q |
18 |
tttcttttggtgcttttgctctctttggggctttctctctttgggttcggcctggccccgcctgtggggtgt-----gctgtttcctttgtggaggtttg |
112 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
12874506 |
tttcttttggtgcttttgccctctctggggctttctctctttggtttcggcctggccccgcctgtggggtgtattgtgttgtttcctttgtggaggtttg |
12874407 |
T |
|
| Q |
113 |
gtggagagtc |
122 |
Q |
| |
|
|||||||||| |
|
|
| T |
12874406 |
gtggagagtc |
12874397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 22 - 122
Target Start/End: Original strand, 4778312 - 4778417
Alignment:
| Q |
22 |
ttttggtgcttttgctctctttggggctttctctctttgggttcggcctggccccgcctgtgggg-----tgtgctgtttcctttgtggaggtttggtgg |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
4778312 |
ttttggtgcttttgctctctctggggctttctctctttgggttcggtctggccctgcctgtggggtgtgatgtgctgtttcctttggggaggtttggtgg |
4778411 |
T |
|
| Q |
117 |
agagtc |
122 |
Q |
| |
|
|||||| |
|
|
| T |
4778412 |
agagtc |
4778417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University