View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20007_low_6 (Length: 239)
Name: NF20007_low_6
Description: NF20007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20007_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 54472302 - 54472534
Alignment:
| Q |
1 |
tatttttatatatctcctatttcnnnnnnnaataggaatttgcaaataagcatgttatgaagtttagaatagttaatggaggaag------------tta |
88 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
54472302 |
tatttttatatatctcctatttctttttttaataggaatttgcaaataagcatgttatgaagtttagaatagttaatgggggaagctaattaattaatta |
54472401 |
T |
|
| Q |
89 |
attaattaatgattcatagcctattcttannnnnnngatcagaaatggatcctctaaagcttttgcatggtgccatagtcgacgcggtagaggatccaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472402 |
attaattaatgattcatagcctattcttatttttttgatcagaaatggatcctctaaagcttttgcatggtgccatagtcgacgcggtagaggatccaaa |
54472501 |
T |
|
| Q |
189 |
tttgaatcttatgtagctacaatatggtgttgc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
54472502 |
tttgaatcttatgtagctacaatatggtgttgc |
54472534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University