View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20008_high_23 (Length: 276)
Name: NF20008_high_23
Description: NF20008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20008_high_23 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 35200530 - 35200807
Alignment:
| Q |
1 |
gaggactacaaaatctgtttatccacccatatcttctgtgttttgctttatctttctttaattattgttacttttttgcttaaaagcttagctgcttacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35200530 |
gaggactacaaaatctgtttatccacccatatcttctgtgttttgctttatctttctttaattattgttacttttttgcttaaaagcttagctgcttacc |
35200629 |
T |
|
| Q |
101 |
acatggttatgtacatcaaggttccattccatgccaccatctcatggctgatctctcttcctcactctctgacacactcacactccattaacggtttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35200630 |
acatggttatgtacatcaaggttccattccatgccaccatctcatggctgatctctcttcctcactctctgacacactcacactccattaacggtttatt |
35200729 |
T |
|
| Q |
201 |
gtcttttcatt--nnnnnnncaagaacaaaagtgatatctttggtcaacatggatgagagaagaaaattatggagtag |
276 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35200730 |
gtcttttgattaaaaaaaaacaagaacaaaagtgatatctttggtcaacatggatgagagaagaaaattatggagtag |
35200807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University