View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20008_high_28 (Length: 237)
Name: NF20008_high_28
Description: NF20008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20008_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 21 - 146
Target Start/End: Complemental strand, 27000869 - 27000748
Alignment:
| Q |
21 |
atgtggtgtcccaatctcatgttaatcctagatcattggcctgttatttctcgtcactcaacaggcatgacaatttatttatttatttatccaggttgca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
27000869 |
atgtggtgtcccaatctcatgttaatcctagatcattggcctgttatttgtcgtcactcaacagtcatgacaatttatttat----ttatccaggttgca |
27000774 |
T |
 |
| Q |
121 |
tgttgcttcttgttacttgtctatat |
146 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
27000773 |
tgttgcttcttgttaattgtctatat |
27000748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 142 - 237
Target Start/End: Complemental strand, 27000924 - 27000829
Alignment:
| Q |
142 |
tatataagaaagatgacccatataactaattaatgccttaaaattttgggtggagatgtgatgtcccaatcttatgttaatcctagatcattggcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27000924 |
tatataagaaagatgacccatataactaattaatgccttaaaattttgggtggagatgtggtgtcccaatctcatgttaatcctagatcattggcc |
27000829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University