View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20008_low_29 (Length: 279)
Name: NF20008_low_29
Description: NF20008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20008_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 50264087 - 50264341
Alignment:
| Q |
18 |
attagtgcatttaaaccatcatcataaggtgctggaagaggattttctggtgctaacctatagttaactgacataatcaagcaaccaacttttgaagata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50264087 |
attagtgcatttaaaccatcatcataaggtgctggaagaggattttctggtgctaacctatagttaactgacataatcaagcaaccaacttttaaagata |
50264186 |
T |
 |
| Q |
118 |
gcatagcaagaaattcatggtagcaactccaagctgcagaaccaacacagaaaccaccaccatgaaaatacactaacaaaggtagnnnnnnnngtgaaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
50264187 |
gcatagcaagaaattcatggtagcaactccaagctgcagaaccaacacagaaaccaccaccatgaaaatacactaacaaaggtagttttttttgtggaga |
50264286 |
T |
 |
| Q |
218 |
atttggaacatagaaacgtgcccaaatgtttgtaacactgtcaatgatgatgtcc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50264287 |
atttggaacatagaaacgtgcccaaatgtttgtaacactgtcaatgataatgtcc |
50264341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University