View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20008_low_32 (Length: 265)
Name: NF20008_low_32
Description: NF20008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20008_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 35201044 - 35200789
Alignment:
| Q |
1 |
tttctctattaagatagtatttattcataaagggagagacaaattaacagaagtatataatgataaacnnnnnnnnnnnnn-tgaaacaagaacaatcaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35201044 |
tttctctattaagatagtatttattcataaagggagagacaaattaacagaagtatataatgataaacaaaaataaaaaaaatgaaacaagaacaatcaa |
35200945 |
T |
 |
| Q |
100 |
tatgtttatatgatgtactaaaagttccaaatgaaagggacaaaaaaccaccatgtggctctttacatctcaagaagactcaattgaattacacaacgag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35200944 |
tatgtttatatgatgtactaaaagttccaaatgaaagggacaaaaaaccaccatgtggctctttacatctcaagaagactcaattgaattacacaacgag |
35200845 |
T |
 |
| Q |
200 |
gtcacactttgcatttgtaattaaaaga--ctttgttctactccataatattcttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
35200844 |
gtcacactttgcatttgtaattaaaagactctttgttctactccataattttcttc |
35200789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University