View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20008_low_43 (Length: 217)
Name: NF20008_low_43
Description: NF20008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20008_low_43 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 56 - 217
Target Start/End: Original strand, 39084202 - 39084363
Alignment:
| Q |
56 |
catgatttttcggagaatttgccggaaataatggaagggagaccagattatttgaataggcagatttcagggaaagggtggaagcctagcttggatacta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084202 |
catgatttttcggagaatttgccggaaataatggaagggagaccagattatttgaataggcagatttcagggaaagggtggaagcctagcttggatacta |
39084301 |
T |
 |
| Q |
156 |
ttaaggagaagaatattgagaaaaaacatactcattggttgttcctcaagagtttttagtgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084302 |
ttaaggagaagaatattgagaaaaaacatactcattggttgttcctcaagagtttttagtgg |
39084363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 105 - 168
Target Start/End: Complemental strand, 44729815 - 44729752
Alignment:
| Q |
105 |
atttgaataggcagatttcagggaaagggtggaagcctagcttggatactattaaggagaagaa |
168 |
Q |
| |
|
|||||| |||||| | |||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
44729815 |
atttgagtaggcaattatcagggaaagggtggaagcctagcttggatacaattaaggaaaagaa |
44729752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University