View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20009_high_11 (Length: 320)
Name: NF20009_high_11
Description: NF20009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20009_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 19 - 308
Target Start/End: Original strand, 54029634 - 54029927
Alignment:
| Q |
19 |
atgtgggtgtctcgccatggacgaggtgaagatcttcttgcagacctttaattgtatgtaactcagatgacctgcttctctcatcatggtgtcgagttgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
54029634 |
atgtgggtgtctcgccatggacgaggtgaagatcttcttgcagatctttaattgtatgtaactcagctgacctgcttctctcatcattgtgtcgagttgg |
54029733 |
T |
 |
| Q |
119 |
acgacggcgactcaaggtgctgtgcagcgatgcaacttttgggatagaaaaaactttcaaggagagacaaggtggaaataaaactgaaaattaaaataga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54029734 |
acgacggcgactcaaggtgctgtgcagcgatgcaacttttgggatagaaaaaacgttcaaggagagacaaggtggaaataaaactgaaaattaaaataga |
54029833 |
T |
 |
| Q |
219 |
aggtgagatggttgagattggattgaa----tgaatgcaggattccattgaccgccgatcccatacatatccgtcaatgatgcattatcatatt |
308 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54029834 |
aggtgaaatggttgagattggattgaatgtgtgaatgcaggattccattgaccgctgatcccatacatatccgtcaatgatgcattatcatatt |
54029927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University