View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20009_high_18 (Length: 241)
Name: NF20009_high_18
Description: NF20009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20009_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 106 - 192
Target Start/End: Complemental strand, 40849852 - 40849766
Alignment:
| Q |
106 |
gtgaaaaaattgttagggcctgaaacnnnnnnngaggcaatattttgtttatggagttataagaaaccatctcattgtgtcttattt |
192 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40849852 |
gtgaaaaaattgttagggcctggaacaaaaaaagaggcaatattttgtttatggagttataagaaaccatctcattgtgtcttattt |
40849766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 40849744 - 40849697
Alignment:
| Q |
178 |
cattgtgtcttatttgttcaccttgtttttagtgtagcgtttttcata |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40849744 |
cattgtgtcttatttgttcaccttgtttttagtgtagcgtttttcata |
40849697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 43
Target Start/End: Complemental strand, 40849981 - 40849952
Alignment:
| Q |
14 |
tttattatgttttatttcattgagtttgac |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40849981 |
tttattatgttttatttcattgagtttgac |
40849952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University