View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20009_low_18 (Length: 270)
Name: NF20009_low_18
Description: NF20009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20009_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 47352322 - 47352144
Alignment:
| Q |
15 |
aggaagcaagattcatgagtatcatacctgcaccaagacccaagaagttcaatggcatacctgtgcaccagataaagataaaagatcagacaagttatct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47352322 |
aggaagcaagattcatgagtatcatacctgcaccaagacccaagaagttcaatggcatacctgtgcaccagataaagataaaagatcagacaagttatct |
47352223 |
T |
|
| Q |
115 |
ctaaagtaataagaaaaatgacgagagagggatgggggtggggaggagctaacttggtattgactctagagcatttttaca |
195 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47352222 |
ctaaagtaataagaaaagtgacgagagacggatgggggtggggaggagctaacttggtattga--ctagagcatttttaca |
47352144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 202 - 270
Target Start/End: Complemental strand, 47352084 - 47352016
Alignment:
| Q |
202 |
attgcattattttctaggattttgatactcagaaaggaaataacacagggaagaacaacaacacataac |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47352084 |
attgcattattttctaggattttgatactcagaaaggaaataacacagggaagaacaacaacacataac |
47352016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University