View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20009_low_21 (Length: 252)
Name: NF20009_low_21
Description: NF20009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20009_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 33399417 - 33399185
Alignment:
| Q |
1 |
gtctcctgtaccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
33399417 |
gtctcctgtaccctcacctacaccggcccctcaagcagcaccaccttcaaatgcaccatggaccgctccccgccggtccctgctgcaaaagtagctattc |
33399318 |
T |
|
| Q |
101 |
aaaacgattcacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagtgactaaaatcattaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33399317 |
aaaacgattcacaggaatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagttactaaaatcattaat |
33399218 |
T |
|
| Q |
201 |
tatttattttctttatgttggtgaatttattta |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33399217 |
tatttattttctttatgttggtgaatttattta |
33399185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 33395533 - 33395394
Alignment:
| Q |
1 |
gtctcctgtaccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattc |
100 |
Q |
| |
|
|||||| || ||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |||| |||||||| |||| ||||||||||||| |
|
|
| T |
33395533 |
gtctccggtgccctcacctacaccgtcccctgaagtagcaccgccttcaaatgcaccatggaccgctgcccgccggtccctactgccaaagaagctattc |
33395434 |
T |
|
| Q |
101 |
aaaacgattcacaggaatctgataactgtttgagattgga |
140 |
Q |
| |
|
|||| ||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
33395433 |
aaaatgattcacagaaatttgatagctgtttgagattgga |
33395394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 33395617 - 33395566
Alignment:
| Q |
10 |
accctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
61 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
33395617 |
accctcacctacaccggcccatgaagcagcaccgtcttcaaatgcaccatgg |
33395566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 33399600 - 33399549
Alignment:
| Q |
10 |
accctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
61 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33399600 |
accctcacctgtgccggcccctgaagcagcaccgccttcaaatgcaccatgg |
33399549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 33399500 - 33399450
Alignment:
| Q |
11 |
ccctcacctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
61 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
33399500 |
ccctcacctacaccagcccctgaagccgcacctccttcaaatgcaccatgg |
33399450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University