View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20009_low_23 (Length: 213)

Name: NF20009_low_23
Description: NF20009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20009_low_23
NF20009_low_23
[»] chr3 (2 HSPs)
chr3 (16-138)||(47352144-47352264)
chr3 (145-213)||(47352016-47352084)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 16 - 138
Target Start/End: Complemental strand, 47352264 - 47352144
Alignment:
16 acctgtgcaccagataaagataaaagatcagacaagttatctctaaagtaataagaaaaatgacgagagagggatgggggtggggaggagctaacttggt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||    
47352264 acctgtgcaccagataaagataaaagatcagacaagttatctctaaagtaataagaaaagtgacgagagacggatgggggtggggaggagctaacttggt 47352165  T
116 attgactctagagcatttttaca 138  Q
    |||||  ||||||||||||||||    
47352164 attga--ctagagcatttttaca 47352144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 47352084 - 47352016
Alignment:
145 attgcattattttctaggattttgatactcagaaaggaaataacacagggaagaacaacaacacataac 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47352084 attgcattattttctaggattttgatactcagaaaggaaataacacagggaagaacaacaacacataac 47352016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University