View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20009_low_24 (Length: 209)
Name: NF20009_low_24
Description: NF20009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20009_low_24 |
 | |
|
| [»] chr7 (5 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 33399762 - 33399554
Alignment:
| Q |
1 |
aacaagtggacatgataaaattgcattgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399762 |
aacaagtggacatgataaaattgcattgacaacctatgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcata |
33399663 |
T |
|
| Q |
101 |
aatgttttgccaaaacaagatggttggtatccagcaccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgcctt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399662 |
aatgttttaccaaaacaagatggttggtatccagcaccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgcctt |
33399563 |
T |
|
| Q |
201 |
caaatgcac |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
33399562 |
caaatgcac |
33399554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 33395871 - 33395672
Alignment:
| Q |
5 |
agtggacatgataaaattgcattgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatg |
104 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||| |||||||||||||||||||||| ||| |||||||| | ||| ||||||||||||||||| | |
|
|
| T |
33395871 |
agtggacatgatacaattttattgacaacctatggaagaagatggtacatttcaggtgctgctcatcactgcaatcttggccaaaagcttttcataaacg |
33395772 |
T |
|
| Q |
105 |
ttttgccaaaacaagatggttggtatccagcaccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaa |
204 |
Q |
| |
|
| |||| ||| |||||||| ||||| |||||| ||||||||||||||| |||||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
33395771 |
tgcagccaccacagtttggttggtctccagtaccctc---accttcagcctccccgtcaccctcacctgtgccgactcctgaagcagcaccaccttcaaa |
33395675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 29 - 134
Target Start/End: Complemental strand, 33442050 - 33441945
Alignment:
| Q |
29 |
acaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatgttttgccaaaacaagatggttggt |
128 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33442050 |
acaacctatgggagaagatggtacatttcaagtgttaccgatcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggt |
33441951 |
T |
|
| Q |
129 |
atccag |
134 |
Q |
| |
|
||||| |
|
|
| T |
33441950 |
ctccag |
33441945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 29 - 134
Target Start/End: Complemental strand, 33452270 - 33452165
Alignment:
| Q |
29 |
acaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttttcataaatgttttgccaaaacaagatggttggt |
128 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33452270 |
acaacctatgggagaagatggtacatttcaagtgttaccgatcactgcgaaaatggacaaaagcttttcataactgtgcagccaaaacaagatggttggt |
33452171 |
T |
|
| Q |
129 |
atccag |
134 |
Q |
| |
|
||||| |
|
|
| T |
33452170 |
ctccag |
33452165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 33395622 - 33395571
Alignment:
| Q |
158 |
ccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcac |
209 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
33395622 |
ccctcaccctcacctacaccggcccatgaagcagcaccgtcttcaaatgcac |
33395571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University