View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20010_high_16 (Length: 277)
Name: NF20010_high_16
Description: NF20010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20010_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 31854480 - 31854296
Alignment:
| Q |
1 |
aaagaaaaacatatataagaacttaggttgaagattaatttacattgacgaagcagtcatgaaaatgaagacgaagaagagatcctcccatacgaggttc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31854480 |
aaagaaaagcatatataagaacttagtttgaagataaatttacattgacaaagcagtcatgaaaatggagacgaagaagagatcctcccatacgaggttc |
31854381 |
T |
 |
| Q |
101 |
tctagcaacagcagagtgaacaactgagtttacagccttaaaaacattgggacacttcttagcatagaaattttcagatagttga |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31854380 |
tctagcaacagcagagtgaacaactgagtttacagccttaaaaacattgggacacttcttagcatagaaattttcagatagttga |
31854296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 233 - 264
Target Start/End: Complemental strand, 31854248 - 31854217
Alignment:
| Q |
233 |
taagtttagtgaaactttagaagaagaaagtg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31854248 |
taagtttagtgaaactttagaagaagaaagtg |
31854217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 75
Target Start/End: Complemental strand, 23229845 - 23229807
Alignment:
| Q |
37 |
aatttacattgacgaagcagtcatgaaaatgaagacgaa |
75 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
23229845 |
aatttacattgacaaagcaatcatgaaaatgaagacgaa |
23229807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University