View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20010_high_19 (Length: 243)
Name: NF20010_high_19
Description: NF20010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20010_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 38890689 - 38890901
Alignment:
| Q |
13 |
catcagcagcaacaacaaaatcaaacggaggattcaccgcgttaatctgatccttattattccaatacaaaatcgagtatttcagattcttcttcagaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38890689 |
catcagcagcaacaacaaaatcaaacggaggattcaccgcgttaatctgatccttattattccaatacaaaatcgagtatttcagattcttcttcagaac |
38890788 |
T |
|
| Q |
113 |
gggtttattcgatttgagattcttcttgagtgcgggcataaccggagggatatcggtgaggatgatgtcggtgagtccgagaaggtagagacccatgccg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38890789 |
gggtttattcgatttgagattcttcttgagtgcgggcataaccggagggatatcggtgaggatgatgtcggtgagtccgagaaggtagagacccatgcca |
38890888 |
T |
|
| Q |
213 |
gcgacgccgcaac |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38890889 |
gcgacgccgcaac |
38890901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University