View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20010_high_24 (Length: 205)
Name: NF20010_high_24
Description: NF20010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20010_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 27155151 - 27154980
Alignment:
| Q |
16 |
atgaataactataaaattgagacaaaatcattacctgatttaatgtggaagctaccagggggtggtatatagggtccaacatatgcatcccctttcgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27155151 |
atgaataactataaaattgagacaaaatcattacttgatttaatgtggaagctaccagggggtggtatatagggtccaacatatgcatcccctttcgttt |
27155052 |
T |
 |
| Q |
116 |
tcttcttcctaaacgcnnnnnnnncagctgccacaactatggcgacaaccaaaactgctgcaatggcataag |
187 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27155051 |
tcttcttcctaaacgcaaaaaaaacagctgccacaactatggcgacaaccaaaactgcggcaatggcataag |
27154980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University