View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20010_low_12 (Length: 328)
Name: NF20010_low_12
Description: NF20010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20010_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 27421741 - 27422066
Alignment:
| Q |
1 |
catagatcaccttttttcttgtaccattacctacctcggcaaattaaattaagcacaccttttctcaaacggtggtagacaaacgcaaaacacacctaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27421741 |
catagatcaccttttttcttgtaccattacctacctcggcaaattaaattaagcacaccttttctcaaacggtggtagacaaacgcaaaacacacctaac |
27421840 |
T |
|
| Q |
101 |
ttgttttctacgttattgtgagcaacgccattctcttttttggtaacctaatttggtg------------cctcgagtgatgacacaacacaatgctctt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
27421841 |
ttgttttctacgttattgtgagcaacgccattctcttttttggtaacctaatttgttgcactcttctctacctcgagtgatgacacaacactatgctctt |
27421940 |
T |
|
| Q |
189 |
tgaactctcttagtagtatgccatggttcgatacattctctgattcacacagaacttatcattcatagtgct----tattttt----tactcatttacta |
280 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
27421941 |
tgaaccctct---tagtatgccatggttcgatacattctcttattcacacataacttatcattcatagtgcttaagtattttttaagtact-atttacta |
27422036 |
T |
|
| Q |
281 |
actttatatggggattgaaaaccaatttag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27422037 |
actttatatggggattgaaaaccaatttag |
27422066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University