View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20010_low_15 (Length: 279)
Name: NF20010_low_15
Description: NF20010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20010_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 42737961 - 42737717
Alignment:
| Q |
19 |
cctttggctccaccaagtggtgtctccgttttgagaaaagttgtagggtacataacatagtatctatcttgtgtatctattgcaacaaattcaaattatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42737961 |
cctttggctccaccaagtggtgtctccgttttgagaaaagttgtagggtacataacatagtatctatcttgtgtatctgttgcaacaaattcaaattatt |
42737862 |
T |
 |
| Q |
119 |
tttggatagatatatgggaaagtgcttgcacattggacattcagtaaaatatttcattcgagcaactactgaattatagcgatgcaatctatcttttgag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42737861 |
tttggatagatatatgggaaagtgcttgcacattggacattcagtaaaatatttcattcgagcaactactaaattatagcgatgcaatctatcttttgag |
42737762 |
T |
 |
| Q |
219 |
cttaacaattagtggcacagtgtgctgctttaattttatctgata |
263 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42737761 |
cttagcaattagtggcacagtgtgctgctttaattttatctgata |
42737717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University