View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20010_low_20 (Length: 243)

Name: NF20010_low_20
Description: NF20010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20010_low_20
NF20010_low_20
[»] chr2 (1 HSPs)
chr2 (13-225)||(38890689-38890901)


Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 38890689 - 38890901
Alignment:
13 catcagcagcaacaacaaaatcaaacggaggattcaccgcgttaatctgatccttattattccaatacaaaatcgagtatttcagattcttcttcagaac 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38890689 catcagcagcaacaacaaaatcaaacggaggattcaccgcgttaatctgatccttattattccaatacaaaatcgagtatttcagattcttcttcagaac 38890788  T
113 gggtttattcgatttgagattcttcttgagtgcgggcataaccggagggatatcggtgaggatgatgtcggtgagtccgagaaggtagagacccatgccg 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
38890789 gggtttattcgatttgagattcttcttgagtgcgggcataaccggagggatatcggtgaggatgatgtcggtgagtccgagaaggtagagacccatgcca 38890888  T
213 gcgacgccgcaac 225  Q
    |||||||||||||    
38890889 gcgacgccgcaac 38890901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University