View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20011_high_23 (Length: 272)
Name: NF20011_high_23
Description: NF20011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20011_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 1426627 - 1426372
Alignment:
| Q |
1 |
caaatattagtgtcttaaaactcaacttatgttaatttcacttcttttcgtcgaagcaacatagtttaggtcaatgttttagtcgtaaaagcatggagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1426627 |
caaatattagtgtcttaaaactcaacttatgttaatttcacttcttttcgtcgaagcaacataggttaggtcaatgttttagtcgtaaaagcatggagga |
1426528 |
T |
|
| Q |
101 |
ctctaaacttctacttggaggtagtgacatccattatcgaagttttgaatggtttttaaatatcggtcaaccatagatcacatgagacactgctccgccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1426527 |
ctctaaacttctacttggaggtagtgacatccattatcgaagttttgaatggtttttaaatatcggtcaaccatagatcacatgagacactgctccgccc |
1426428 |
T |
|
| Q |
201 |
ttgcaattgccctatattattaccttcaaagcaaacattcatttatgttgttgaaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1426427 |
ttgcaattgccctatattattacctttaaagcaaacattcatttatgttgttgaaa |
1426372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University