View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20011_high_25 (Length: 270)
Name: NF20011_high_25
Description: NF20011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20011_high_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 258
Target Start/End: Original strand, 531210 - 531448
Alignment:
| Q |
20 |
atctggatgggaacaaggtcgtgacccggctctaaccccatttctttaccgaacaaataatccaattgggtcgagattcaaattgcaaagatcatcgaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
531210 |
atctggatgggaacaaggtcgtgacccggctctaaccccatttctttaccgaacaaataatccaattgggtcgagattcaaattgcaaagatcatcggag |
531309 |
T |
|
| Q |
120 |
acacctcgaatgtatcattccactgctgttttggttcgtgatgggagggttttggttggtggtagtaaccctcattcgggttacaatttcacaaatgttt |
219 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
531310 |
acgcctcgaatgtatcattccactgctgttttggttcgtgatgggagggttttggttggtggtagtaaccctcattcgggttacagtttcacaaatgttt |
531409 |
T |
|
| Q |
220 |
tgtttccaaccaagcttagcattgaggcatattcacctt |
258 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
531410 |
tgtttccaactgagcttagcattgaagcatattcacctt |
531448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 229
Target Start/End: Original strand, 7571151 - 7571260
Alignment:
| Q |
120 |
acacctcgaatgtatcattccactgctgttttggttcgtgatgggagggttttggttggtggtagtaaccctcattcgggttacaatttcacaaatgttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||| | ||||||||||| |||||||| ||||||||||| | ||||| | |
|
|
| T |
7571151 |
acacctcgaatgtatcattccactgcaattttggttcgtgatggtagggttcttgttggtggtagcaaccctcacattggttacaattttaacaatgtgt |
7571250 |
T |
|
| Q |
220 |
tgtttccaac |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
7571251 |
tgtttccaac |
7571260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University